|
Revvity
cat b 750 fast Cat B 750 Fast, supplied by Revvity, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cat b 750 fast/product/Revvity Average 86 stars, based on 1 article reviews
cat b 750 fast - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Chem Impex International
adenosine Adenosine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/adenosine/product/Chem Impex International Average 95 stars, based on 1 article reviews
adenosine - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Proteintech
gsk 3β Gsk 3β, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gsk 3β/product/Proteintech Average 96 stars, based on 1 article reviews
gsk 3β - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Proteintech
β catenin ![]() β Catenin, supplied by Proteintech, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/β catenin/product/Proteintech Average 99 stars, based on 1 article reviews
β catenin - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Chem Impex International
nanoluc control assays ![]() Nanoluc Control Assays, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nanoluc control assays/product/Chem Impex International Average 95 stars, based on 1 article reviews
nanoluc control assays - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Proteintech
anti acetyl β catenin ![]() Anti Acetyl β Catenin, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti acetyl β catenin/product/Proteintech Average 96 stars, based on 1 article reviews
anti acetyl β catenin - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
ra10657693 ctgttggattg attcgaaatc plkopuro u6to tetr s438 ctgttggattgattcgaaatt ctcgaggatttcgaatcaatcc aacagttttt b cat shrna ![]() Ra10657693 Ctgttggattg Attcgaaatc Plkopuro U6to Tetr S438 Ctgttggattgattcgaaatt Ctcgaggatttcgaatcaatcc Aacagttttt B Cat Shrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ra10657693 ctgttggattg attcgaaatc plkopuro u6to tetr s438 ctgttggattgattcgaaatt ctcgaggatttcgaatcaatcc aacagttttt b cat shrna/product/Thermo Fisher Average 86 stars, based on 1 article reviews
ra10657693 ctgttggattg attcgaaatc plkopuro u6to tetr s438 ctgttggattgattcgaaatt ctcgaggatttcgaatcaatcc aacagttttt b cat shrna - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Proteintech
total β catenin ![]() Total β Catenin, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/total β catenin/product/Proteintech Average 93 stars, based on 1 article reviews
total β catenin - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Chem Impex International
macrospin columns ![]() Macrospin Columns, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/macrospin columns/product/Chem Impex International Average 95 stars, based on 1 article reviews
macrospin columns - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
STEMCELL Technologies Inc
t and b activation kits cat number: 100-0645 ![]() T And B Activation Kits Cat Number: 100 0645, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t and b activation kits cat number: 100-0645/product/STEMCELL Technologies Inc Average 90 stars, based on 1 article reviews
t and b activation kits cat number: 100-0645 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Boulder Scientific Co
cpme4)(cppr)zrcl2 catalyst c-1 ![]() Cpme4)(Cppr)Zrcl2 Catalyst C 1, supplied by Boulder Scientific Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpme4)(cppr)zrcl2 catalyst c-1/product/Boulder Scientific Co Average 90 stars, based on 1 article reviews
cpme4)(cppr)zrcl2 catalyst c-1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: American Journal of Cancer Research
Article Title: NRSN2 promotes osteosarcoma cell proliferation and growth through PI3K/Akt/MTOR and Wnt/β-catenin signaling
doi:
Figure Lengend Snippet: NRSN2 regulates PI3K/Akt/GSK3β axis and Wnt/β-catenin signaling in osteosarcoma cells. A. The level of phosphorylated Akt, mTOR, p-GSK3β and nuclear β-catenin (nu-β-catenin) are positively correlated with the level of NRSN2 in U2OS and MG63 cells. B. Luciferase reporter assays revealed that NRSN2 could regulate Wnt/β-catenin signaling in U2OS and MG63 cells. C. Knockdown NRSN2 inhibits the expression of CCND1 and c-myc in U2OS cells. D. Overexpression of NRSN2 elevates the mRNA levels of CCND1 and c-myc in MG63 cells. E. The pro-proliferation effect was reversed when treated with IWR-1-endo, a inhibitor of β-catenin. *p<0.05, **p<0.01.
Article Snippet: The following antibodies were used in this study: NRSN2 (1:1000, Proteintech), GAPDH (1:5000,
Techniques: Luciferase, Expressing, Over Expression
Journal: Biomedicines
Article Title: HDAC9 Contributes to Serous Ovarian Cancer Progression through Regulating Epithelial–Mesenchymal Transition
doi: 10.3390/biomedicines10020374
Figure Lengend Snippet: HDAC9 may inhibit EMT in A2780 cells by suppressing β-catenin signaling. A2780 and SKOV3 cells were transfected with a HDAC9 overexpression construct, HDAC9-shRNA plasmids (siHDAC9-1/2), or empty vector for 24 h. ( A , B ) Immunofluorescence staining for β-catenin in A2780 and SKOV3 cells (bar = 30 um). ( C ) Nucleus of A2780 and SKOV3 cells were isolated and the expression of β-catenin was investigated. ( D ) The expression of β-catenin and ac-β-catenin (Lys-49) in A2780 and SKOV3 cells was measured by Western blot.
Article Snippet: The following antibodies were used: anti-HDAC9, anti-vimentin (Abcam, Cambridge, MA, USA); anti-TGF-β, anti-SMAD2/3, anti-P-SMAD2(S465 + S467)/P-SMAD3(S423 + S425) (Wanleibio, China); anti-E-cadherin, anti-N-cadherin, anti-snail, anti-FOXO1, anti-β-catenin, anti-beta actin, anti-lamin A/C, anti-alpha-tubulin (
Techniques: Transfection, Over Expression, Construct, shRNA, Plasmid Preparation, Immunofluorescence, Staining, Isolation, Expressing, Western Blot
Journal: Biomedicines
Article Title: HDAC9 Contributes to Serous Ovarian Cancer Progression through Regulating Epithelial–Mesenchymal Transition
doi: 10.3390/biomedicines10020374
Figure Lengend Snippet: Proposed model by which HDAC9 affects EMT and cell migration in serous and non-serous ovarian cancer. In serous ovarian cancer, HDAC9 promotes TGF-β expression by deacetylating FOXO1 and increasing its nuclear accumulation. Upregulated TGF-β promotes cell migration via activating EMT. In non-serous ovarian cancer, HDAC9 inhibits EMT and cell migration by deacetylating β-catenin and decreasing its nuclear localization. Promote (→); Inhibit (⇢).
Article Snippet: The following antibodies were used: anti-HDAC9, anti-vimentin (Abcam, Cambridge, MA, USA); anti-TGF-β, anti-SMAD2/3, anti-P-SMAD2(S465 + S467)/P-SMAD3(S423 + S425) (Wanleibio, China); anti-E-cadherin, anti-N-cadherin, anti-snail, anti-FOXO1, anti-β-catenin, anti-beta actin, anti-lamin A/C, anti-alpha-tubulin (
Techniques: Migration, Expressing
Journal: Diabetes
Article Title: Overexpression of circulating soluble Nogo-B improves diabetic kidney disease by protecting the vasculature
doi: 10.2337/db19-0157
Figure Lengend Snippet: Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased total β-catenin levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).
Article Snippet: The following primary antibodies were utilised: Nogo-B (N-terminus, R&D System, Abingdon, UK); NgBR (Abcam, Cambridge, UK); α-tubulin (Santa Cruz Biotechnology, Heidelberg, Germany); β-actin; pan-AKT, GSK3β, phospho-AKT (Ser 473 ), phospho-eNOS (Ser 1177 ), and phospho-GSK3β Ser9 (Cell Signalling, Leiden, The Netherlands); eNOS (Santa Cruz Biotechnology, Heidelberg, Germany);
Techniques: Over Expression