b cat Search Results


86
Revvity cat b 750 fast
Cat B 750 Fast, supplied by Revvity, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cat b 750 fast/product/Revvity
Average 86 stars, based on 1 article reviews
cat b 750 fast - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

95
Chem Impex International adenosine
Adenosine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/adenosine/product/Chem Impex International
Average 95 stars, based on 1 article reviews
adenosine - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

96
Proteintech gsk 3β
Gsk 3β, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gsk 3β/product/Proteintech
Average 96 stars, based on 1 article reviews
gsk 3β - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

99
Proteintech β catenin
NRSN2 regulates PI3K/Akt/GSK3β axis <t>and</t> <t>Wnt/β-catenin</t> signaling in osteosarcoma cells. A. The level of phosphorylated Akt, mTOR, p-GSK3β and nuclear β-catenin (nu-β-catenin) are positively correlated with the level of NRSN2 in U2OS and MG63 cells. B. Luciferase reporter assays revealed that NRSN2 could regulate Wnt/β-catenin signaling in U2OS and MG63 cells. C. Knockdown NRSN2 inhibits the expression of CCND1 and c-myc in U2OS cells. D. Overexpression of NRSN2 elevates the mRNA levels of CCND1 and c-myc in MG63 cells. E. The pro-proliferation effect was reversed when treated with IWR-1-endo, a inhibitor of β-catenin. *p<0.05, **p<0.01.
β Catenin, supplied by Proteintech, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/β catenin/product/Proteintech
Average 99 stars, based on 1 article reviews
β catenin - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

95
Chem Impex International nanoluc control assays
NRSN2 regulates PI3K/Akt/GSK3β axis <t>and</t> <t>Wnt/β-catenin</t> signaling in osteosarcoma cells. A. The level of phosphorylated Akt, mTOR, p-GSK3β and nuclear β-catenin (nu-β-catenin) are positively correlated with the level of NRSN2 in U2OS and MG63 cells. B. Luciferase reporter assays revealed that NRSN2 could regulate Wnt/β-catenin signaling in U2OS and MG63 cells. C. Knockdown NRSN2 inhibits the expression of CCND1 and c-myc in U2OS cells. D. Overexpression of NRSN2 elevates the mRNA levels of CCND1 and c-myc in MG63 cells. E. The pro-proliferation effect was reversed when treated with IWR-1-endo, a inhibitor of β-catenin. *p<0.05, **p<0.01.
Nanoluc Control Assays, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nanoluc control assays/product/Chem Impex International
Average 95 stars, based on 1 article reviews
nanoluc control assays - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

96
Proteintech anti acetyl β catenin
HDAC9 may inhibit EMT in A2780 cells by <t>suppressing</t> <t>β-catenin</t> signaling. A2780 and SKOV3 cells were transfected with a HDAC9 overexpression construct, HDAC9-shRNA plasmids (siHDAC9-1/2), or empty vector for 24 h. ( A , B ) Immunofluorescence staining for β-catenin in A2780 and SKOV3 cells (bar = 30 um). ( C ) Nucleus of A2780 and SKOV3 cells were isolated and the expression of β-catenin was investigated. ( D ) The expression of β-catenin and ac-β-catenin (Lys-49) in A2780 and SKOV3 cells was measured by Western blot.
Anti Acetyl β Catenin, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti acetyl β catenin/product/Proteintech
Average 96 stars, based on 1 article reviews
anti acetyl β catenin - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

86
Thermo Fisher ra10657693 ctgttggattg attcgaaatc plkopuro u6to tetr s438 ctgttggattgattcgaaatt ctcgaggatttcgaatcaatcc aacagttttt b cat shrna
HDAC9 may inhibit EMT in A2780 cells by <t>suppressing</t> <t>β-catenin</t> signaling. A2780 and SKOV3 cells were transfected with a HDAC9 overexpression construct, HDAC9-shRNA plasmids (siHDAC9-1/2), or empty vector for 24 h. ( A , B ) Immunofluorescence staining for β-catenin in A2780 and SKOV3 cells (bar = 30 um). ( C ) Nucleus of A2780 and SKOV3 cells were isolated and the expression of β-catenin was investigated. ( D ) The expression of β-catenin and ac-β-catenin (Lys-49) in A2780 and SKOV3 cells was measured by Western blot.
Ra10657693 Ctgttggattg Attcgaaatc Plkopuro U6to Tetr S438 Ctgttggattgattcgaaatt Ctcgaggatttcgaatcaatcc Aacagttttt B Cat Shrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ra10657693 ctgttggattg attcgaaatc plkopuro u6to tetr s438 ctgttggattgattcgaaatt ctcgaggatttcgaatcaatcc aacagttttt b cat shrna/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
ra10657693 ctgttggattg attcgaaatc plkopuro u6to tetr s438 ctgttggattgattcgaaatt ctcgaggatttcgaatcaatcc aacagttttt b cat shrna - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

93
Proteintech total β catenin
Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased <t>total</t> <t>β-catenin</t> levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).
Total β Catenin, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/total β catenin/product/Proteintech
Average 93 stars, based on 1 article reviews
total β catenin - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

95
Chem Impex International macrospin columns
Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased <t>total</t> <t>β-catenin</t> levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).
Macrospin Columns, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/macrospin columns/product/Chem Impex International
Average 95 stars, based on 1 article reviews
macrospin columns - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

90
STEMCELL Technologies Inc t and b activation kits cat number: 100-0645
Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased <t>total</t> <t>β-catenin</t> levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).
T And B Activation Kits Cat Number: 100 0645, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t and b activation kits cat number: 100-0645/product/STEMCELL Technologies Inc
Average 90 stars, based on 1 article reviews
t and b activation kits cat number: 100-0645 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Boulder Scientific Co cpme4)(cppr)zrcl2 catalyst c-1
Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased <t>total</t> <t>β-catenin</t> levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).
Cpme4)(Cppr)Zrcl2 Catalyst C 1, supplied by Boulder Scientific Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cpme4)(cppr)zrcl2 catalyst c-1/product/Boulder Scientific Co
Average 90 stars, based on 1 article reviews
cpme4)(cppr)zrcl2 catalyst c-1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


NRSN2 regulates PI3K/Akt/GSK3β axis and Wnt/β-catenin signaling in osteosarcoma cells. A. The level of phosphorylated Akt, mTOR, p-GSK3β and nuclear β-catenin (nu-β-catenin) are positively correlated with the level of NRSN2 in U2OS and MG63 cells. B. Luciferase reporter assays revealed that NRSN2 could regulate Wnt/β-catenin signaling in U2OS and MG63 cells. C. Knockdown NRSN2 inhibits the expression of CCND1 and c-myc in U2OS cells. D. Overexpression of NRSN2 elevates the mRNA levels of CCND1 and c-myc in MG63 cells. E. The pro-proliferation effect was reversed when treated with IWR-1-endo, a inhibitor of β-catenin. *p<0.05, **p<0.01.

Journal: American Journal of Cancer Research

Article Title: NRSN2 promotes osteosarcoma cell proliferation and growth through PI3K/Akt/MTOR and Wnt/β-catenin signaling

doi:

Figure Lengend Snippet: NRSN2 regulates PI3K/Akt/GSK3β axis and Wnt/β-catenin signaling in osteosarcoma cells. A. The level of phosphorylated Akt, mTOR, p-GSK3β and nuclear β-catenin (nu-β-catenin) are positively correlated with the level of NRSN2 in U2OS and MG63 cells. B. Luciferase reporter assays revealed that NRSN2 could regulate Wnt/β-catenin signaling in U2OS and MG63 cells. C. Knockdown NRSN2 inhibits the expression of CCND1 and c-myc in U2OS cells. D. Overexpression of NRSN2 elevates the mRNA levels of CCND1 and c-myc in MG63 cells. E. The pro-proliferation effect was reversed when treated with IWR-1-endo, a inhibitor of β-catenin. *p<0.05, **p<0.01.

Article Snippet: The following antibodies were used in this study: NRSN2 (1:1000, Proteintech), GAPDH (1:5000, Proteintech), p-Akt, Akt, p-mTOR, mTOR, p-GSK3β, GSK3β, β-catenin and the second antibodies were purchased from Cell Signaling Technology and with 1:1000 dilutions.

Techniques: Luciferase, Expressing, Over Expression

HDAC9 may inhibit EMT in A2780 cells by suppressing β-catenin signaling. A2780 and SKOV3 cells were transfected with a HDAC9 overexpression construct, HDAC9-shRNA plasmids (siHDAC9-1/2), or empty vector for 24 h. ( A , B ) Immunofluorescence staining for β-catenin in A2780 and SKOV3 cells (bar = 30 um). ( C ) Nucleus of A2780 and SKOV3 cells were isolated and the expression of β-catenin was investigated. ( D ) The expression of β-catenin and ac-β-catenin (Lys-49) in A2780 and SKOV3 cells was measured by Western blot.

Journal: Biomedicines

Article Title: HDAC9 Contributes to Serous Ovarian Cancer Progression through Regulating Epithelial–Mesenchymal Transition

doi: 10.3390/biomedicines10020374

Figure Lengend Snippet: HDAC9 may inhibit EMT in A2780 cells by suppressing β-catenin signaling. A2780 and SKOV3 cells were transfected with a HDAC9 overexpression construct, HDAC9-shRNA plasmids (siHDAC9-1/2), or empty vector for 24 h. ( A , B ) Immunofluorescence staining for β-catenin in A2780 and SKOV3 cells (bar = 30 um). ( C ) Nucleus of A2780 and SKOV3 cells were isolated and the expression of β-catenin was investigated. ( D ) The expression of β-catenin and ac-β-catenin (Lys-49) in A2780 and SKOV3 cells was measured by Western blot.

Article Snippet: The following antibodies were used: anti-HDAC9, anti-vimentin (Abcam, Cambridge, MA, USA); anti-TGF-β, anti-SMAD2/3, anti-P-SMAD2(S465 + S467)/P-SMAD3(S423 + S425) (Wanleibio, China); anti-E-cadherin, anti-N-cadherin, anti-snail, anti-FOXO1, anti-β-catenin, anti-beta actin, anti-lamin A/C, anti-alpha-tubulin (Proteintech, Chicago, IL, USA); anti-Acetyl-β-catenin (Lys49), anti-slug (Cell Signaling Technology, Beverly, MA, USA).

Techniques: Transfection, Over Expression, Construct, shRNA, Plasmid Preparation, Immunofluorescence, Staining, Isolation, Expressing, Western Blot

Proposed model by which HDAC9 affects EMT and cell migration in serous and non-serous ovarian cancer. In serous ovarian cancer, HDAC9 promotes TGF-β expression by deacetylating FOXO1 and increasing its nuclear accumulation. Upregulated TGF-β promotes cell migration via activating EMT. In non-serous ovarian cancer, HDAC9 inhibits EMT and cell migration by deacetylating β-catenin and decreasing its nuclear localization. Promote (→); Inhibit (⇢).

Journal: Biomedicines

Article Title: HDAC9 Contributes to Serous Ovarian Cancer Progression through Regulating Epithelial–Mesenchymal Transition

doi: 10.3390/biomedicines10020374

Figure Lengend Snippet: Proposed model by which HDAC9 affects EMT and cell migration in serous and non-serous ovarian cancer. In serous ovarian cancer, HDAC9 promotes TGF-β expression by deacetylating FOXO1 and increasing its nuclear accumulation. Upregulated TGF-β promotes cell migration via activating EMT. In non-serous ovarian cancer, HDAC9 inhibits EMT and cell migration by deacetylating β-catenin and decreasing its nuclear localization. Promote (→); Inhibit (⇢).

Article Snippet: The following antibodies were used: anti-HDAC9, anti-vimentin (Abcam, Cambridge, MA, USA); anti-TGF-β, anti-SMAD2/3, anti-P-SMAD2(S465 + S467)/P-SMAD3(S423 + S425) (Wanleibio, China); anti-E-cadherin, anti-N-cadherin, anti-snail, anti-FOXO1, anti-β-catenin, anti-beta actin, anti-lamin A/C, anti-alpha-tubulin (Proteintech, Chicago, IL, USA); anti-Acetyl-β-catenin (Lys49), anti-slug (Cell Signaling Technology, Beverly, MA, USA).

Techniques: Migration, Expressing

Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased total β-catenin levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).

Journal: Diabetes

Article Title: Overexpression of circulating soluble Nogo-B improves diabetic kidney disease by protecting the vasculature

doi: 10.2337/db19-0157

Figure Lengend Snippet: Diabetes was paralleled by a 2/3-fold increase in the ratio of phosphorylated p-AKTSer473/total AKT (a, n=6-8/group), a significant elevation of the ratio of phosphorylated p-GSK3βSer9/total GSK3β (b, n=8/group) and increased total β-catenin levels (c, n=8/group) in kidney cortex lysates (ND-GFP vs D-GFP, *p≤0.007). Diabetes-mediated AKT and GSK3β phosphorylation and upregulation β-catenin levels were partially or totally prevented by sNogo-B overexpression in the circulation (D-GFP vs D-sNogo-B, #p≤0.04; ND-sNogo-B vs D-sNogo-B, **p=0.0001). ANOVA with LSD post-hoc test (mean±SD) for all comparisons. AAV-GFP treated mice black circles (●), AAV-sNogo-B treated mice white circles (○).

Article Snippet: The following primary antibodies were utilised: Nogo-B (N-terminus, R&D System, Abingdon, UK); NgBR (Abcam, Cambridge, UK); α-tubulin (Santa Cruz Biotechnology, Heidelberg, Germany); β-actin; pan-AKT, GSK3β, phospho-AKT (Ser 473 ), phospho-eNOS (Ser 1177 ), and phospho-GSK3β Ser9 (Cell Signalling, Leiden, The Netherlands); eNOS (Santa Cruz Biotechnology, Heidelberg, Germany); total β-catenin (Proteintech, Manchester, UK).

Techniques: Over Expression